Skip to Content
-
Sort By: Featured
High range Dualsize:color presize:stained protein markers 11 proteins ~10size:175 kda for Western SDSsize:PAGE ,200 ul
223.50 € 223.5 EUR
High Sensitivity Rat Cardiac Troponinsize:I ELISA kit, 1 x 96 wells for serum
851.25 € 851.25 EUR
High Sensitivity Kanamycin ELISA Test Kit 96 Tests
1,560.00 € 1560.0 EUR
High Sensitivity Cardiac Troponin I, hssize:cTnI, ELISA Kit size: 96size:Stripsize:Wells
705.00 € 705.0 EUR
High Sensitivity 8size:Hydroxydeoxyuanisine 8size:OHdG Elisa Assay Kit, 96 Tests
1,430.00 € 1430.0 EUR
High Sensitive ELISA Kit for Neurofilament, Light Polypeptide NEFL size: 96 Tests
950.00 € 950.0 EUR
High Sensitive ELISA Kit for Defensin Alpha 5, Paneth Cell Specific DEFa5
967.00 € 967.0 EUR
High Reverse Transcriptase RNase Hsize: 10, 000U
885.00 € 885.0 EUR
High NTsize:Pro BNP Serum Human Fluid 1 sample
634.00 € 634.0 EUR
High Density Nickel Agarose Resin x 1 Unit 500 mL
1,600.00 € 1600.0 EUR
High Density Glyoxal 6BCL size: 25 ml
265.50 € 265.5 EUR
High Density Cobalt Agarose Resin x 1 Unit 10ml
1,600.00 € 1600.0 EUR
Hifair V Reverse Transcriptase size: 200000 U
5,510.25 € 5510.25 EUR
Hifair AdvanceFast 1st Strand cDNA Synthesis Kit No Dye size: 11150ES size: 100T
344.25 € 344.25 EUR
Hieff Trans Liposomal Transfection Reagentsize: 1ml
387.00 € 387.0 EUR
Hieff Trans Liposomal Transfection Reagent size: 0.5ml
257.00 € 257.0 EUR
Hieff NGS DNA Selection Beads size: 60 mL
607.00 € 607.0 EUR
Hieff NGS OnePot Pro DNA Library Prep Kit for Illumina size: 8 T
520.00 € 520.0 EUR
HiStrep Identification Kit x 5
190.00 € 190.0 EUR
HiScript Ⅳ 1st Strand cDNA Synthesis Kit +gDNA wiper size: 50 Reactionss
337.00 € 337.0 EUR
HiScript Ⅳ 1st Strand cDNA Synthesis Kit +gDNA wiper size: 10 Reactionss free sample
0.00 € 0.0 EUR
HiScript IV RT SuperMix for qPCR +gDNA wiper size: 100 rxns
496.00 € 496.0 EUR
HiScript III RT SuperMix for qPCR +gDNA wiper size: 100 Reactions 20µL/Reaction
435.00 € 435.0 EUR
HiScript III Allsize:insize:one RT SuperMix Perfect for qPCR size: 10rxns free sample
0.00 € 0.0 EUR
HiScript III Allsize:insize:one RT SuperMix Perfect for qPCR size: 100 rxns
413.25 € 413.25 EUR
HiScript III 1st Strand cDNA Synthesis Kit +gDNA wiper size: 50 Reactionss
154.83 € 154.83 EUR
HiScript II Reverse Transcriptase Glycerolsize:free size: 10000 U
152.00 € 152.0 EUR
HiScript III 1st Strand cDNA Synthesis Kit +gDNA wiper size: 100 reactions
227.05 € 227.05 EUR
HiCrome Rapid ECC Broth, 500G
366.00 € 366.0 EUR
HiCrome Candida Differential Agar
519.00 € 519.0 EUR
Hexokinase Domain Containing 1 HKDC1 Antibody size: 400 µL
818.00 € 818.0 EUR
Hexane Sulphonic Acid Sodium Salt Anhydrous for HPLC, 99% size: 25g
120.00 € 120.0 EUR
Hexacosanoylsize:Lsize:Carnitine Biochemical
639.00 € 639.0 EUR
Hexa His tag peptide size: 25mg
670.00 € 670.0 EUR
HexR1: 5’size:TACTTATCNACRGCYTGRTTCCAsize:3’
215.00 € 215.0 EUR
HexF1: 5’size:GAYRGYHGGRTNBTGGAYATGGGsize:3’
215.00 € 215.0 EUR
Hex L1size:s: 5’size:ATGGGAGCSACCTAYTTCGACATsize:3’
215.00 € 215.0 EUR
Hex L1size:as: 5’size:AAATTGTCCCKRAANCCGATGTAsize:3’
215.00 € 215.0 EUR
Herpes simplex type 2 size: One step size: 150 Reactions
589.00 € 589.0 EUR
Hepatitis E virus One Step PCR Kit size: 100 reactions
1,942.00 € 1942.0 EUR
Hepatitis D Virus Antigen ELISA Kit size: 96 Tests
1,438.00 € 1438.0 EUR
Hepatitis B Surface Antigen adr subtype, CHO Protein size: 100 µg
499.00 € 499.0 EUR
Hepatitis B Surface Antigen adr subtype, CHO Protein size: 1 mg
1,965.00 € 1965.0 EUR
Hepatitis A Virus Antibody – S/P/WB
125.00 € 125.0 EUR
Heparinase III EC 4.2.2.8 from Flavobacterium heparinum, 0.5 IU, #AMS.HEPsize:ENZ III
949.00 € 949.0 EUR
Heparinsize:Coated Microplates Clear size: 5 Plates
283.00 € 283.0 EUR
Heparinsize:Coated Microplates Clear size: 25 Plates
592.00 € 592.0 EUR
Heparinsize:Coated Microplates Clear size: 10 Plates
377.00 € 377.0 EUR
Heparin Coated Psize:1000 Tips; 1 Box
286.40 € 286.4 EUR
Heparin Binding protein EIA
890.00 € 890.0 EUR
Heparin Binding Protein ELISA 96 det.
1,410.70 € 1410.7 EUR
Heparan Sulfate delta Mab 3G10 epitope MoxHu size: 50 µG
977.50 € 977.5 EUR
Heparan Sulfate Mab MoxHu 10E4 epitope size: 50 µG
977.50 € 977.5 EUR
Hemoglobin High Sensitivity Colorimetric Detection Kit 2 Plate size: 2x96 well plate
680.00 € 680.0 EUR
Hemoglobin Colorimetric Detection Kit 2 plate
565.00 € 565.0 EUR
Hemoglobin A1c size: R1: 1 x 30 mL, R2: 1 x 10 mL, Hemolysis: 1 x 125 mL
575.70 € 575.7 EUR
HemogloBind Trial Kitsize:5 mL Hemoglobind & 5 preps of NuGelsize:HemogloBind™
639.00 € 639.0 EUR
HemogloBind Hemoglobin Depletion From Hemolyzed Serum/Plasma size: 50 mL
2,194.75 € 2194.75 EUR
HemogloBind Hemoglobin Depletion From Hemolyzed Serum/Plasma size: 15mL
1,029.25 € 1029.25 EUR
HemoVoid size: Hemoglobin Variant Enrichment Kit From Blood size: 10 preps
830.00 € 830.0 EUR
HemoVoid size: Hemoglobin Depletion From Erythrocytes size: 5 preps
500.00 € 500.0 EUR
HemoTrial Kit:5 mL HemogloBind™, 5 preps of NuGel size:HemogloBind™, 5 preps HemoVoid™
709.00 € 709.0 EUR
Hemin Assay size: 100 Assays
550.00 € 550.0 EUR
Hemin CAS N°16009size:13size:5 ; Purity 99.59% size: Spec 3 kg
4,194.00 € 4194.0 EUR
Hemin CAS N°16009size:13size:5 , Purity >95.0% T size: 25 G
1,268.00 € 1268.0 EUR
Hematology Analyzer Lyse WFLsize:LD size: 250 mL
312.00 € 312.0 EUR
Hematology Analyzer Lyse WFLsize:LD size: 250 mL
290.00 € 290.0 EUR
Hematology Analyzer Diluent size: 20L
280.00 € 280.0 EUR
Hematology Analyzer Diluent size: 2 L
286.00 € 286.0 EUR
Hemacytometersize:Disposable Semen Test , 50 PCs
352.00 € 352.0 EUR
Hemacytometersize:Disposable Semen test size: 20PCES
176.00 € 176.0 EUR
HemaVision® size:inv16N, 25 test
1,431.30 € 1431.3 EUR
HemaVision® size:9;22N | HV02size:922N, 25 tests
1,431.30 € 1431.3 EUR
HemaVision® size:8;21N | HV02size:821N, 25 test
1,431.30 € 1431.3 EUR
HemaVision® size:15;17N | HV02size:1517N, 25 tests
1,431.30 € 1431.3 EUR
Hellma R absorption cuvettes, Micro
369.00 € 369.0 EUR
Helixyteâ„¢ 14 [Equivalent to SYBR 14] *5 mM* 0.5ml
422.00 € 422.0 EUR
Helasize:RFP stable cells size: 2 x 106 cell/ml x 1ml
1,275.00 € 1275.0 EUR
Heat shock 30% solution Fraction V Serological,1 L
1,300.00 € 1300.0 EUR
Head and neck cancer tissue array, including pathology grade, TNM and clinical stage AJCC 8th edition , 60 cases/60 cores
422.00 € 422.0 EUR
HeLa Whole Cell Lysate size: 500 µg
570.00 € 570.0 EUR
HeLa Cell Line size: One Frozen vial
1,026.00 € 1026.0 EUR
HbA1c elisa kit :: Mouse Glycated Hemoglobin A1c HbA1c ELISA Kit size: 48 Strip Wells
618.81 € 618.81 EUR
HbA1c Rapid Test Cassette size:10T
31.44 € 31.44 EUR
HbA1c Control size: L1 & L2: 2 x 0.5mL each, lyophilized
299.00 € 299.0 EUR
HbA1c Calibrator size: 5 x 0.5 mL, lyophilized
304.80 € 304.8 EUR
Haspin GSG2 NM_031965 Human Oversize:expression Lysate size: 20 µg
340.00 € 340.0 EUR
Harringtoninesize:10mg
510.00 € 510.0 EUR
Harringtonine size: 5mg
320.00 € 320.0 EUR
Hantavirus Renal Syndrome Typing I&II Real Time RTsize:PCR Kit size: 25 reactions
1,472.00 € 1472.0 EUR
HantaVirus Renal Syndrome Type II Real Time RTsize:PCR Kit size: 25 reactions
1,345.00 € 1345.0 EUR
Ham's Fsize:12（Customised ingredients: only without methionine size: 500 mL
162.00 € 162.0 EUR
Ham's Fsize:12K, without phenol red size: 500 mL
140.00 € 140.0 EUR
Ham's Fsize:12K w/oMethionine Culture Media size: 500 mL
162.00 € 162.0 EUR
Ham's Fsize:12K w/Lsize:Glutamine,Cysteine w/oMethionine Culture Media size: 500 mL
162.00 € 162.0 EUR
Ham's Fsize:12K w/Lsize:Glutamine w/o Methionine, Cysteine Culture Media size: 500 mL
162.00 € 162.0 EUR
Haemophilus Influenzae Stock Quantitative 1mL
900.55 € 900.55 EUR
Haematoxylin Harris size: 2.5L
178.00 € 178.0 EUR
Haematoxylin & Eosin Stain Kit H&E size: 100 Test
54.00 € 54.0 EUR
HaeII size: 10000 U 500 µl
480.00 € 480.0 EUR
HYsize:16685 size: 2070018size:29size:8 size: 5mg
1,750.00 € 1750.0 EUR
HUMANsize:BASED SYNTHETIC STOOL MIX W/ HSA & HGDNA size: 250 ml
3,164.00 € 3164.0 EUR
HUMAN TYPE II ALVEOLAR EPITHELIAL Donor available: Male: age 38, 44, 55; Female: age 29, 33, 45, 57
4,512.00 € 4512.0 EUR
HUMAN SKELETAL MUSCLE MYOBLASTS Medium Kit size: 1 kit
1,376.00 € 1376.0 EUR
HUMAN SKELETAL MUSCLE MYOBLASTS size: 1 vial
3,344.00 € 3344.0 EUR
HUMAN SEBOCYTES, 1 vial
4,046.00 € 4046.0 EUR
HUMAN RETINAL PIGMENT EPITHELIAL CELLS
3,264.00 € 3264.0 EUR
HUMAN PULMONARY ALVEOLAR EPITHELIAL Lots available: Lot#M1425size:FY72size: Donor information: 72 y/o female donor. lot#2541size:FY58 size: Donor information: 58 y/o female donor. lot#145236m size: Donor information: 31 y/o male donor.
3,708.00 € 3708.0 EUR
HUMAN PANCREATIC STELLATE CELLS Medium Kit
816.00 € 816.0 EUR
HUMAN PANCREATIC STELLATE CELLS , 1 vial
3,040.00 € 3040.0 EUR
HUMAN OLIGODENDROCYTE PROGENITOR CELLS size: 1 vial
3,140.00 € 3140.0 EUR
HUMAN NEURONS, 1 vial
3,870.00 € 3870.0 EUR
HUMAN NEURONS Growth Medium Kit
1,060.80 € 1060.8 EUR
HUMAN MICROGLIA,cell line, 1 vial
3,258.00 € 3258.0 EUR
HUMAN ITPR2 ELISA KIT size: 96 Tests
986.00 € 986.0 EUR
HUMAN INTESTINAL EPITHELIAL CELLS , 1 vial
3,360.00 € 3360.0 EUR
HUMAN INSULINsize: DEGRADING ENZYME, IDE ELISA KIT size: 96 Tests
1,004.00 € 1004.0 EUR
HUMAN DOPAMINERGIC NEURON CELLS
3,569.00 € 3569.0 EUR
HUMAN DENTAL PULP STEM CELLS Growth Medium Kit , 1 kit
799.00 € 799.0 EUR
HUMAN CLEC2D ELISA KIT size: 96 Tests
750.00 € 750.0 EUR
HUMAN BRAIN MICROVASCULAR ENDOTHELIAL CELLS, 1 vial
1,891.00 € 1891.0 EUR
HUMAN ASTROCYTES size: 1 vial
4,362.00 € 4362.0 EUR
HUMAN ANTIsize:KLH IGG ELISA, 96 tests
800.00 € 800.0 EUR
HU TOPO IIA 500 UNITS
750.00 € 750.0 EUR
HU TOPO IIA 500 UNITS
1,385.00 € 1385.0 EUR
HU TOPO IIA 250 UNITS
734.00 € 734.0 EUR
HU TOPO IIA 1K UNITS
1,680.00 € 1680.0 EUR
HTLV p19 Antigen ELISA,96 Determinations
1,104.00 € 1104.0 EUR
HT115 10 tubes
915.00 € 915.0 EUR
HT115 DE3 Escherichia coli Strainssize:100ul
406.00 € 406.0 EUR
HTsize:29size:MTXsize:E12, 1 frozen vial
1,510.00 € 1510.0 EUR
HTsize:29 size: One Frozen vial
3,890.00 € 3890.0 EUR
HT Colorimetric PARP Apoptosis Assay Kit 96T
1,137.50 € 1137.5 EUR
HSV2 IgG/IgM Rapid Test CE
0.00 € 0.0 EUR
HSV type 1 Glycosylated aa 21 size: 339 [His], 1 mg
3,516.00 € 3516.0 EUR
HSV 1 & 2 Positive Control size: 6 x 0.25 mL
390.55 € 390.55 EUR
HSP90 elisa kit :: Human Heat Shock Protein 90 HSP90 ELISA Kit size: 96size:Stripsize:Wells
740.00 € 740.0 EUR
HSP70 | Heat shock protein 70 cytoplasmic size: 50 µl
500.00 € 500.0 EUR
HSP101 | ClpB heat shock protein, Nsize:terminal rabbit antibody
600.00 € 600.0 EUR
HSL Antibody Primary Rabbit Polyclonal size: 200µL
565.00 € 565.0 EUR
HSD17B14 Antibody size: middle region ARP56865_P050
0.00 € 0.0 EUR
HSD17B14 Antibody size: middle region ARP56865_P050
230.00 € 230.0 EUR
HSD17B10 elisa kit :: Rat 3size:hydroxyacylsize:CoA Dehydrogenase Typesize:2 HSD17B10 ELISA Kit size: 96size:Stripsize:Wells
952.00 € 952.0 EUR
HSD11B2 enzyme :: Hydroxysteroid Dehydrogenase, 11size:beta, Type I Enzyme 0.1MG
805.00 € 805.0 EUR
HSsize:CRP elisa kit :: Human High Sensitivity Csize:Reactive Protein ELISA Kit size: 96 Tests
1,054.00 € 1054.0 EUR
HS Human ILsize:1β Interleukin 1 Beta ELISA Kit size: 96 Tests
500.00 € 500.0 EUR
HS Human ILsize:10 Interleukin 10 ELISA Kit size: 96 Tests
500.00 € 500.0 EUR
HS Human IFNsize:γ Interferon Gamma ELISA Kit size: 96 Tests
500.00 € 500.0 EUR
HRSV A Presize:fusion glycoprotein F0, His Tag MALS verified size: 50 µg
640.00 € 640.0 EUR
HRPsize:SA Streptavidin Horseradish Peroxidase Activity ELISA Kit, 96 test
660.00 € 660.0 EUR
HRPsize:Goat Antisize:Rabbit Secondary Antibody size: 350 µg
321.00 € 321.0 EUR
HRP*Polyclonal Rabbit Antisize:Goose IgY IgG （h+l） Concentration :1mg/mL size: 10 mL
975.00 € 975.0 EUR
HRP*Polyclonal Rabbit Antisize:Goose IgY IgG （h+l） Concentration :1mg/mL size: 1 mL
415.00 € 415.0 EUR
HRP*Monoclonal Mouse Antisize: Human IgG1 size: 1 mg
832.00 € 832.0 EUR
HRP conjugated Goat Antisize:Human IgG H+L 100ul
236.00 € 236.0 EUR
HRP Conjugated Chicken antisize:Csize:MYC, 0.1 mg
432.00 € 432.0 EUR
HRP Conjugated AffiniPure Goat Antisize:Rabbit IgG H+L size: 0.5ml
380.00 € 380.0 EUR
HRP CONJUGATED SAMBUCUS NIGRA ELDERBERRY BARK size:SNAsize:Isize:, 1 mg
544.00 € 544.0 EUR
HRP CONJUGATED MAACKIA AMURENSIS LECTIN size:MAAsize:, 1 mg
493.00 € 493.0 EUR
HQExo Exosomesize:SKsize:Nsize:SH size: 1 vial/ > 1x10^8 particles
1,970.00 € 1970.0 EUR
HPX elisa kit :: Human Hemopexin ELISA Kit size: 96size:Stripsize:Wells x 3 sztuki.
3,150.00 € 3150.0 EUR
HPVsize:16 E6/E7 Stable Expression Hacat Cell Line Clone #11 size: 1x106 cells / 1.0 mL
7,020.00 € 7020.0 EUR
HP210
0.00 € 0.0 EUR
HPsize:CAGA elisa kit :: Human Helicobacter Pylori Caga ELISA Kit size: 96 wells
1,126.00 € 1126.0 EUR
HP elisa kit :: Sheep Haptoglobin ELISA Kit size: 1x96 Wells
708.00 € 708.0 EUR
HOXA5 Antibody size: 100µL
452.00 € 452.0 EUR
HORSE IGG T ELISA, 96 T
660.00 € 660.0 EUR
HORSE BLOOD LYSED size: 100 mL
499.00 € 499.0 EUR
HO1 elisa kit :: Mouse Heme Oxygenase 1, Decycling HO1 ELISA Kitsize:96size:Stripsize:Wells
925.00 € 925.0 EUR
HNS Antibody size: 100 µL
375.00 € 375.0 EUR
HNP1size:3 elisa kit :: Human HNP1size:3 ELISA Kitsize:96size:Stripsize:Wells
742.00 € 742.0 EUR
HMGB1 elisa kit :: Human highsize:mobility group box 1 ELISA Kit size: 96size:Stripsize:Wells
1,300.00 € 1300.0 EUR
HMGB1 elisa kit :: Human High mobility group protein B1 ELISA Kitsize:96size:Stripsize:Wells
725.00 € 725.0 EUR
HMGB1 Express ELISA
1,896.70 € 1896.7 EUR
HMGsize:CoA Reductase Assay Kit size: 100 Assays
1,150.00 € 1150.0 EUR
HLsize:60 Cells size: 1x10<sup>6</sup> cells / 1.0 mL
910.00 € 910.0 EUR
HKsize:2 Cells
2,150.00 € 2150.0 EUR
HIVsize:1 tat, Strain IIIB, Recombinant Human Immunodeficiency Virussize:1 size: 0.1mg
2,132.00 € 2132.0 EUR
HIVsize:1 env gp120, Strain YU2 Active Protein, 0.1 mg
1,649.00 € 1649.0 EUR
HIVsize:1 RNA EDTA Positive Plasma size: 10 X 1.2 mL
2,037.00 € 2037.0 EUR
HIVsize:1 RNA EDTA Positive Plasma size: 1 mL
1.00 € 1.0 EUR
HIV Seroconversion Panel Donor# 75062 15 X 1 mL
3,068.00 € 3068.0 EUR
HIV Seroconversion Panel Donor# 73698 13 X 1 mL
3,068.00 € 3068.0 EUR
HIV Seroconversion Panel Donor# 73695 9 X 1 mL
3,068.00 € 3068.0 EUR
HIV Seroconversion Panel Donor# 65522 5 X 1 mL
2,416.00 € 2416.0 EUR
HIV Seroconversion Panel Donor# 65376 6 X 1 mL
2,416.00 € 2416.0 EUR
HIV Seroconversion Panel Donor# 63331 7 X 1 mL
2,416.00 € 2416.0 EUR
HIV Seroconversion Panel Donor No. 75018
3,068.00 € 3068.0 EUR
HIV Realsize:TM Quant Dx size: 96T
1,116.50 € 1116.5 EUR
HIV 1/2 Rapid Test Verification Panel size: 10 X 0.25mL
520.00 € 520.0 EUR
HIS Histamine ELISA Kit size: 96 Tests
640.00 € 640.0 EUR
HIS Histamine ELISA Kit size: 96 Tests
593.00 € 593.0 EUR
HIS Lite Cy5 Tris NTAsize:Ni Complex size: 100 µg
310.00 € 310.0 EUR
HIS Lite Cy3 Tris NTAsize:Ni Complex size: 100 µg
310.00 € 310.0 EUR
HIGHQC™️ HUMAN NEURAL STEM CELLS: HNSC BRAIN CORTEX size: 1 vial
2,350.00 € 2350.0 EUR
HIGHQC™️ HUMAN DENTAL PULP STEM , 1 vial
3,229.00 € 3229.0 EUR
HIF3A elisa kit :: Human HIF3A Hypoxiasize:inducible factor 3size:alpha ELISA Kit size: 96 wells
731.00 € 731.0 EUR
HIF2a elisa kit :: Human Hypoxia Inducible Factor 2 Alpha HIF2a ELISA Kit size: 96 wells
1,068.00 € 1068.0 EUR
HIF1A elisa kit :: Human Hypoxiasize:inducible factor 1size:alpha ELISA Kit size: 96 wells
731.00 € 731.0 EUR
HIF1A Antibody size: Nsize:terminal region ARP30572_P050 size:100µL
771.00 € 771.0 EUR
HGCsize:27 size: 1 Frozen Vial
4,380.00 € 4380.0 EUR
HEPES Buffer Solution Liquid – Liquid, 100 ML
99.00 € 99.0 EUR
HEPACAM elisa kit :: Human hepatocyte cell adhesion molecule ELISA Kit size: 96 Tests
1,054.00 € 1054.0 EUR
HEPA Filter Biosafety Cabinet, 4 ft
19,447.00 € 19447.0 EUR
HEK293T size: One vial
3,125.00 € 3125.0 EUR
HEK293 Human embryonic kidney cell line: >1x10^10 frozen exosomes size: 50 ug
650.00 € 650.0 EUR
HEK 293 HCP Standards Asize:F size: 1 mL
1,285.00 € 1285.0 EUR
HEK 293 HCP ELISA Kit 3G size: 96 Wells
1,808.00 € 1808.0 EUR
HECsize:1size:B, one vial
3,719.00 € 3719.0 EUR
HECsize:1size:A, 1 vial
3,719.00 € 3719.0 EUR
HDL Purification Kit Ultracentrifugation Free size: 10 preps
650.00 € 650.0 EUR
HDAC4 Active Proteinsize:0.01 mg
790.00 € 790.0 EUR
HD Clear Sealing Tape size: 50 m
77.20 € 77.2 EUR
HD Clear Sealing Tape size: 1.88 inches wide
270.00 € 270.0 EUR
HCV/HBV/HIV1/HIV2 Realsize:TM size: 100T
1,432.00 € 1432.0 EUR
HCV Strip Serum/Plasma , 50 tests
90.00 € 90.0 EUR
HCV Realsize:TM Quant size: 100T
984.50 € 984.5 EUR
HCV Cassette Serum/Plasma , 25 tests/pack
60.00 € 60.0 EUR
HCGsize:alpha Antibody [clone hCGa/7870]
371.00 € 371.0 EUR
HBsAg/HCV Ab Rapid Test, 30 tests
133.00 € 133.0 EUR
HBsAg recombinant protein :: Hepatitis B Surface Antigen adr subtype Recombinant Protein size: 0.1 mg
558.00 € 558.0 EUR
HBsAg ELISA | CTKsize:E0710; 96 Tests
403.00 € 403.0 EUR
HBsAB size: 96 Tests/box
30.50 € 30.5 EUR
HBeAg Test Serum/Plasma size: 25 Tests
1.00 € 1.0 EUR
HBeAg CLIA Kit 96T /Chemiluminescent immunoassay/
543.50 € 543.5 EUR
HBeAg size: 96 Tests/box
30.50 € 30.5 EUR
HBeAb Rapid Test Cassette Serum/Plasma size: 25 Tests
334.36 € 334.36 EUR
HBa1 recombinant protein :: Hemoglobin Alpha 1 HBa1 Recombinant Protein size: 0.5 mg
1,500.00 € 1500.0 EUR
HBV Seroconversion Panel Donor# 65556 6 X 1 mL
1,366.00 € 1366.0 EUR
HBV RTsize:PCR Quant Dx CE | V5size:96/3FRT size: 96T
1,010.00 € 1010.0 EUR
HBV Quantitative Real Time PCR Kit size: 32RXS
2,232.00 € 2232.0 EUR
HBV LONGITUDINAL PANEL 11 X 1 mL
2,013.00 € 2013.0 EUR
HAZ Paraformaldehyde 16% Sol methanolsize:free 10x10ml
296.00 € 296.0 EUR
HAV Realsize:TM Qual size: 50 Tests
475.00 € 475.0 EUR
HAMP elisa kit :: Pig Hepcidin ELISA Kit 96 Tests
1,143.00 € 1143.0 EUR
HAMA blocking reagent 50mg
430.00 € 430.0 EUR
HAMA blocking reagent 50mg
320.00 € 320.0 EUR
HAMA blocking reagent 1g
2,480.00 € 2480.0 EUR
HAMA blocking reagent size: 50 mg
203.00 € 203.0 EUR
HAMA blocking reagent size: 1g
3,300.00 € 3300.0 EUR
H9size:derived Oligodendrocyte Progenitor Cells OPCs Medium Kit
1,340.00 € 1340.0 EUR
H9size:derived Oligodendrocyte Progenitor Cells OPCs size: 0.5 million
3,060.00 € 3060.0 EUR
H5N1 RNA Control size: Median S2 size: 12 x 0.5mL
350.00 € 350.0 EUR
H5N1 RNA Control size: Low S1 size: 12 x 0.5mL
300.00 € 300.0 EUR
H5N1 RNA Control size: High S3 size: 12 x 0.5mL
400.00 € 400.0 EUR
H5N1 RNA Control size: All Levels size: 18 x 0.5mL
550.00 € 550.0 EUR
H596 cells
826.50 € 826.5 EUR
H441 cells
826.50 € 826.5 EUR
H19 Dye for DNA Relaxation and Supercoiling Assays, 1000 assyas
975.00 € 975.0 EUR
H. pylori Antibody Rapid Test Cassette size: 25 Tests
380.00 € 380.0 EUR
H. pylori Antibody Rapid Test Cassette size: 25 Tests
1.00 € 1.0 EUR
H. pylori Ag Rapid Test, Cs; 25Т/kit
365.00 € 365.0 EUR
Hsize:SPlussize:Taq DNA Polymerase, 1000 Units
369.00 € 369.0 EUR
Hsize:Phosphonate dT. dT Hsize:p size: 50 nmol scale
278.00 € 278.0 EUR
Hsize:Phosphonate dG. dG Hsize:p size: 50 nmol scale
278.00 € 278.0 EUR
Hsize:Phosphonate dC. dC Hsize:p size: 50 nmol scale
278.00 € 278.0 EUR
Hsize:Phosphonate dA. dA Hsize:p size: 50 nmol scale
278.00 € 278.0 EUR
H+ATPase | Plasma membrane H+ATPase rabbit antibody size: 50 µl
550.00 € 550.0 EUR
H pylori, cagA protein size: 50 ug
487.00 € 487.0 EUR
Gulo recombinant protein :: Lsize:gulonolactone oxidase Gulo Recombinant Proteinsize:0.1 mg
3,600.00 € 3600.0 EUR
Guinea pig whole blood size: 100 ml
658.00 € 658.0 EUR
Guinea pig Mucin 5 Subtype AC MUC5AC ELISA Kit
880.00 € 880.0 EUR
Guinea Pig serum 1.0 mL/vial
470.00 € 470.0 EUR
Guinea Pig antisize:Human InsµLin Polyclonal Antibody size:1 mLantisize:INS antibody :: Guinea Pig antisize:Human InsµLin Polyclonal Antibody
532.50 € 532.5 EUR
Guinea Pig adropin AD ELISA kit size: 96 Tests
760.00 € 760.0 EUR
Guinea Pig adropin AD ELISA kit size: 48T
630.00 € 630.0 EUR
Guinea Pig Serum size: 500 mL
1,013.50 € 1013.5 EUR
Guinea Pig Serum size: 100 mL
304.00 € 304.0 EUR
Guinea Pig Blood in Alsevers size: per 50mL
895.00 € 895.0 EUR
Guinea Pig Blood in ACD size: per 50ml
985.00 € 985.0 EUR
Guinea Pig 5%Washed RBC size: per 15mL
539.00 € 539.0 EUR
Guinea Pig 100% Washed RBC size: per 15mL
1,289.00 € 1289.0 EUR
Guinea Pig 10% Washed RBC size: per 15mL
599.00 € 599.0 EUR
Gt antisize:Ms IgG Fc Polystyrene Particles, 0.25%w/v, 0.7size:0.9µm, 20mL
387.00 € 387.0 EUR
Gt antisize:Hu IgG H&L Fluorescent Particles, Yellow, 0.1%w/v, 0.7size:0.9µm, 5mL
217.00 € 217.0 EUR
Gt antisize:Hu IgG H&L Fluorescent Particles, Purple, 0.1%w/v, 0.7size:0.9µm, 5mL
217.00 € 217.0 EUR
Gt antisize:Hu IgG H&L Fluorescent Particles, Nile red, 0.1%w/v, 0.7size:0.9µm, 5mL
217.00 € 217.0 EUR
GsMTx4size:0,5 mg
590.00 € 590.0 EUR
Growth factor reduced matrigels matrix phenol red free 10ml
1,220.00 € 1220.0 EUR
Growth factor reduced matrigels matrix mouse ehs tumor 5ml
700.00 € 700.0 EUR
Growth factor reduced matrigel matrix 10ml vial
747.00 € 747.0 EUR
Griffithsin Antibody size: 100 µL
400.00 € 400.0 EUR
Greiner 96 well TC treated plate black uclear with lid sterile size: PK32
300.00 € 300.0 EUR
Greiner 24 well TC treated plate with lid sterile size: PK100
286.25 € 286.25 EUR
Greiner 24 Well ComboPlate Case of 24 Plates With Lids
200.00 € 200.0 EUR
Green Live/Dead Dye, 50 µL, 100 tests
323.00 € 323.0 EUR
Graphene Oxide on Quantifoil R1.2/1.3 Cu, 400 mesh, 100/pk
2,643.00 € 2643.0 EUR
Graphene Oxide on Quantifoil R1.2/1.3 Au, 400 mesh, 25/pk
978.00 € 978.0 EUR
Granzyme K human , recombinant , 10 ug
1,407.00 € 1407.0 EUR
GranToxiLuxsize:PLUS Green substrate size: 80 assays
907.00 € 907.0 EUR
Gram Stain Kit Twort Counterstain size: 100 Tests
200.00 € 200.0 EUR
Gram Stain Kit Safranin Counterstain size: 100 Tests
182.00 € 182.0 EUR
Gram Stain Kit Neutral Red Counterstain size: 100 Tests
182.00 € 182.0 EUR
Gram Stain Kit Gram Fuchsin Counterstain size: 100 Tests
182.00 € 182.0 EUR
Goose Genomic DNA, 0.1 mg
491.00 € 491.0 EUR
Goniometer base type B5size:R, MicroRT compatible size: package of 20
445.00 € 445.0 EUR
Goniometer Base Type B5size:R package of 40
670.00 € 670.0 EUR
Goniometer Base Type B5size:R package of 100
1,509.00 € 1509.0 EUR
Gomori Trichrome Stain Kit size: 500 Tests
171.00 € 171.0 EUR
Goat, antisize:S.cerevisiae HCP, affinity purified
4,289.00 € 4289.0 EUR
Goat poxvirus PCR Kit size: 48 rxs
441.50 € 441.5 EUR
Goat mScarlet Polyclonal Antibody size: 0.3mg
571.00 € 571.0 EUR
Goat babesiosis ELISA Kit size: 96 Tests
482.00 € 482.0 EUR
Goat antisize:mouse IgG conjugated with 250mn magnetic nanoparticles, Trophoblasts [fetal cell capture ]
1,260.00 € 1260.0 EUR
Goat antisize:mTurquoise Polyclonal IgG Antibody size: 300 µg
300.00 € 300.0 EUR
Goat antisize:mNeptune Polyclonal IgG Antibody size: 300 µg
338.00 € 338.0 EUR
Goat antisize:mCardinal Polyclonal IgG Antibody size: 300 µg
440.00 € 440.0 EUR
Goat antisize:Rabbit IgG H&L , HRP conjugated size: 1 mg
720.00 € 720.0 EUR
Goat antisize:ORF3a SARSsize:CoVsize:2 Polyclonal IgG Antibody size: 300 µg
436.00 € 436.0 EUR
Goat antisize:Mouse IgE Heavy Chain Antibody HRP Conj µgated size: 1 mg
2,088.00 € 2088.0 EUR
Goat antisize:Dog IgE Polyclonal Antibody size: 1 mg
591.60 € 591.6 EUR
Goat antisize:BFP Polyclonal IgG Antibody size: 300 µg
300.00 € 300.0 EUR
Goat anti human igG HRP 1000ug
308.00 € 308.0 EUR
Goat anti Mouse IgG, 1mg
124.00 € 124.0 EUR
Goat anti Mouse IgG size: 1 mg
124.00 € 124.0 EUR
Goat anti Chicken IgY, 1 mg
124.00 € 124.0 EUR
Goat Peste des Petits Ruminants PPR ELISA Kit size: 96 Tests
864.00 € 864.0 EUR
Goat PLD ELISA Kit 96 Tests
670.00 € 670.0 EUR
Goat IgG powder, 97% purity, 10g
1,238.00 € 1238.0 EUR
Goat Genomic DNA size: 0.1mg
250.00 € 250.0 EUR
Goat Genomic DNA size: 0.1 mg
499.00 € 499.0 EUR
Goat Bluetongue Virus Antibody Antisize:BTV ELISA Kit size: 96 Tests
781.00 € 781.0 EUR
Goat Betasize:casein CSN2 ELISA Kit size: 96 Wells
1,190.00 € 1190.0 EUR
Goat Antisize:mouse IgG H+L colloidal gold conjugated 40 nm, OD10 , 500 µL
570.00 € 570.0 EUR
Goat Antisize:Ty1 tag Polyclonal IgG Antibody size: 100 µg
436.00 € 436.0 EUR
Goat Antisize:Turkey IgG H+L Secondary Antibody size: 1mL
430.00 € 430.0 EUR
Goat Antisize:SARSsize:CoVsize:2 ORF3a SARSsize:CoVsize:2 size: 300 µg
442.00 € 442.0 EUR
Goat Antisize:Rat IgG H&L size: 500 mL
1,105.00 € 1105.0 EUR
Goat Antisize:Rabbit IgG H+L size: 1 mg, CF®488A size: 1 mg
370.00 € 370.0 EUR
Goat Antisize:Rabbit IgG H+L size: 1 mL, HRP SKU : 20402size:1mL Conjugation : HRP
280.80 € 280.8 EUR
Goat Antisize:Rabbit IgG H+L size: 0.5 mL
365.00 € 365.0 EUR
Goat Antisize:Mouse IgG HRP size: 1 mL
1,101.00 € 1101.0 EUR
Goat Antisize:Mouse IgG H+L size:Gold ~10 nm Conjugate 0.20ml
450.00 € 450.0 EUR
Goat Antisize:Mouse IgG H+L Secondary Antibody, Cy3 Conj µgated
345.00 € 345.0 EUR
Goat Antisize:Mouse IgG H+L size: 1 mg
370.00 € 370.0 EUR
Goat Antisize:Mouse IgG H+L size: 0.5 mL, CF®543
365.00 € 365.0 EUR
Goat Antisize:Mouse IgG Fc colloidal gold conjugated 40 nm, OD10 , 500 µL
570.00 € 570.0 EUR
Goat Antisize:Mouse IgEsize:HRP Conjugate size: 500ug
560.00 € 560.0 EUR
Goat Antisize:Mouse IgEsize:HRP Conjugate size: 250 ug
404.00 € 404.0 EUR
Goat Antisize:MDA MD20Asize:G1A 1mg
973.00 € 973.0 EUR
Goat Antisize:Human IgG H&L size: 500 mL
1,105.00 € 1105.0 EUR
Goat Antisize:Human Factor H size: 1ml/vial
426.00 € 426.0 EUR
Goat Antisize:Human C1q size: 1ml/vial
370.00 € 370.0 EUR
Goat Antisize:HFQ Polyclonal IgG Antibody size: 600 µg
376.00 € 376.0 EUR
Goat Antisize:Guinea Pig IgG H+L , Highly Crosssize:Adsorbed size: 50ul
268.00 € 268.0 EUR
Goat Antisize:Guinea Pig IgG H&L size: 500 mL
1,105.00 € 1105.0 EUR
Goat Antisize:Bird IgG H+L size:HRP conjugate size: 0.5ml
440.00 € 440.0 EUR
Goat Anti Rabbit IgG HRP H+L , Goat polyclonal antibody specific for rabbit IgG H+L , purified by affinity chromatography, conj µgated to Horseradish Peroxidase 1.0 mg/mL
660.50 € 660.5 EUR
Glypican 3 size: 250ug
3,579.00 € 3579.0 EUR
Glyphosate ELISA Plate and Derivatization Kitsize: 96 Tests
1,458.82 € 1458.82 EUR
Glycine max lectin SBA size: 50 mg
820.50 € 820.5 EUR
Glycine max Lectin SBA size: Pure, 10mg
467.40 € 467.4 EUR
Glycine max Lectin SBA size: HRP Horseradish Peroxidase size: 2 mg
391.00 € 391.0 EUR
Glycine extrapure AR, ACS, ExiPlus, Multisize:Compendial, 99.5% size: 500g
110.00 € 110.0 EUR
Glycine extrapure AR, ACS, ExiPlus, Multisize:Compendial, 99.5% size: 500g
110.00 € 110.0 EUR
Glycerolsize:Free RnaUsScript Reverse Transcriptase size: 20,000 units 200 units/ul, 100 µL
765.00 € 765.0 EUR
Glycerol monomethacrylate size: 25 g
283.40 € 283.4 EUR
Glycerol 50%, Sterile. 250ml
240.57 € 240.57 EUR
Glycerol 50%, Sterile, 500 ML
256.00 € 256.0 EUR
Glycerol 50%, Sterile solution 100 mL
114.00 € 114.0 EUR
Glycerol CAS N°56size:81size:5 ; Purity: 99.62% size: Spec 100 mL
137.00 € 137.0 EUR
Glutathione Reductase Assay Kit 100 tests
378.80 € 378.8 EUR
Glutathione Coated Polystyrene Particles 0.5% w/v 4.0size:4.9 µm size: 5 mL
313.00 € 313.0 EUR
Glutathione GSH ELISA Kit size: 96 tests
665.01 € 665.01 EUR
Glucosesize:6size:Phosphate Dehydrogenase Activity Assay size: 100 Tests
610.00 € 610.0 EUR
Glucose Isomerase from Streptomyces murinus , Food Grade, 5,000 U/g size: 1 kg
608.00 € 608.0 EUR
Glucose Assay Kit size: 4×50 mL
225.00 € 225.0 EUR
Glucose Assay Kit size: 96 Tests
671.00 € 671.0 EUR
Glucagon Antibody size: 100 µL
388.75 € 388.75 EUR
Global DNA Methylation ELISA Kit 5’size:methylsize:2’size:deoxycytidine Quantitation size: 96 assays
895.00 € 895.0 EUR
GloMelt Thermal Shift Protein Stability Kit with Rox
830.00 € 830.0 EUR
GloMelt Thermal Shift Protein Stability Kit size: 200 assays, No ROX
400.00 € 400.0 EUR
GloMax® 20/20 Luminometer
10,397.00 € 10397.0 EUR
Gliadorphinsize:7 size: 5mg
430.00 € 430.0 EUR
Gliadin GAFsize:3X IgG ELISA size: 96 Tests
850.00 € 850.0 EUR
Gliadin GAFsize:3X IgA ELISA size: 96 Tests
850.00 € 850.0 EUR
Glass Micropipettes size: Presize:Pulled Microcapillaries for Microfluidic Applications size: 30µm internal diameter 4.5 cm length size: 30 pack
819.00 € 819.0 EUR
Glass Micropipettes size: Presize:Pulled Microcapillaries for Microfluidic Applications size: 20µm internal diameter 4.5 cm length size: 30 pack
819.00 € 819.0 EUR
Glass Micropipettes size: Presize:Pulled Microcapillaries for Microfluidic Applications size: Presize:pulled Micropipettes; Part No. MGMsize:1 x 10µm internal diameter 4.5 cm length size: 30 pack
819.00 € 819.0 EUR
Glass Cover Slides size: 18 mm Circular Glass Cover Slides size: Siliconized
335.00 € 335.0 EUR
Glass Beads 1.0mm size: Glass beads. 1.0mm. 1 lb. Nonsize:sterile.
155.00 € 155.0 EUR
Glass Beads 0.5mm size: Glass beads. 0.5mm. 1 lb. Nonsize:sterile
155.00 € 155.0 EUR
Gifu Anaerobic Broth GAM , 500 g
87.00 € 87.0 EUR
Gibco Bacto Yeast Extract Technical
355.00 € 355.0 EUR
Gibco Bacto Yeast Extract
460.00 € 460.0 EUR
Gibco Bacto Proteose Peptone
560.00 € 560.0 EUR
Gibberellic Acid GA3 Solution 1mg/1ml size: 100 mL
30.00 € 30.0 EUR
Giardia lambliasize:S. cerevisiae Recombinant, titered size: 1 mL,
790.00 € 790.0 EUR
Giardia intestinalis, 150 test
1,015.00 € 1015.0 EUR
Giant Knotweed Extract Standard 98% Resveratrol size: 75 g
480.00 € 480.0 EUR
Giant Knotweed Extract Standard 50% Resveratrol size: 75 g
428.00 € 428.0 EUR
Ghrelin Human Total size: RIA Kit size: 125 Tubes
1,300.00 € 1300.0 EUR
Geotrichum candidum PCR size: 96 Reactions
768.00 € 768.0 EUR
Gentodenz Density gradient medium for cell separation size: 250 grams
230.00 € 230.0 EUR
Gentodenz Density gradient medium for cell separation size: 100 grams
150.00 € 150.0 EUR
Gentamicin Sulphate GM size: 1 g
106.00 € 106.0 EUR
Gentamicin Sulfate USP, 25G
475.00 € 475.0 EUR
Gentamicin Solution 50mg/ml 10ml
85.00 € 85.0 EUR
Gentamicin Cn 30 µg size: 5x50 Disc
86.40 € 86.4 EUR
Gentamicin size: 10 mL
184.00 € 184.0 EUR
Genorise® Plasma/Serum DNA Extraction Kit size: 50 Tests
381.00 € 381.0 EUR
Genorise® Blood DNA Extraction Kit size: 200 Tests
675.00 € 675.0 EUR
Genomic DNA Isolation Kitsize:50 assays
569.00 € 569.0 EUR
Genomic DNA size: Mouse Normal Tissue: Brain 100 ug
500.20 € 500.2 EUR
Genipin size: 5G
370.00 € 370.0 EUR
General Vitellogenin, VG ELISA Kit 96 wells
500.00 € 500.0 EUR
General Testosterone ELISA Kit, 96 test
449.00 € 449.0 EUR
General Selenium Assay Kit size: 100 Assays
900.00 € 900.0 EUR
General PTD Pentosidine ELISA Kit size: 96 Tests
480.00 € 480.0 EUR
General Melatonin MT ELISA Kit size: 48T
731.00 € 731.0 EUR
General Heparan sulfate ELISA Kit size: 96 Tests
745.00 € 745.0 EUR
General Estradiol, E2 ELISA Kit, 96 test
479.00 € 479.0 EUR
General Endotoxin ELISA Kit Competitive size: 96 Tests
2,653.00 € 2653.0 EUR
General Cyclic Guanosine Monophosphate cGMP ELISA Kit size: 48 Tests
646.00 € 646.0 EUR
General CML/ N 6 size:Carboxymethyllysine ELISA Kit, 96 tests
558.00 € 558.0 EUR
General Basic Xylanase Assay Kit size: 100 tests
705.00 € 705.0 EUR
General 5size:Hydroxyindoleacetic Acid 5size:HIAA ELISA Kit size: 48 Tests
655.00 € 655.0 EUR
GeneQ thermal cycler, 24x0.2ml
2,527.00 € 2527.0 EUR
GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Kit size: 25 Preps
140.00 € 140.0 EUR
GeneMATRIX Gram Plus & Yeast Genomic DNA Purification Kit size: 100 Preps
375.00 € 375.0 EUR
Gene Synthesis size: Per bp size: 5'UTR sequence from Custom gene: 5'size:CTATCACCTAAGTGTGGGCTAATGTAACAAAGAGGGATT TCACCTACATCCATTCAGTCAGTCTTTGGGGGTTTAAAGA AATTCCAAAGAGTCATCAGAAGAGGAAAAATGAAGGTAATGTTTTTTCAGACAGGTAAAGTCTTTGAAAATATGTGTAATAT GTAAAACATTTTGACACCCCCATAATATTTTTCCAGAATTAA CAGTATAAATTGCATCTCTTGTTCAAGAGTTCCCTATCACT CTCTTTAATCACTACTCACAGTAACCTCAACTCCTGCCAC A size:3' 285bp + 60 bp cloning sites = 345bp Not a deliverable. Use for C452.
300.00 € 300.0 EUR
Gene Synthesis size: Per bp 1640 bp + 60 bp cloning sites
250.31 € 250.31 EUR
GenMute siRNA Transfection Reagent size: 1 mL
264.00 € 264.0 EUR
GenJet In Vitro siRNA Transfection Reagent Ver. II size: 1 mL
331.00 € 331.0 EUR
Gemcitabine, Free Base, >99%, 500 mg
284.00 € 284.0 EUR
Gem21 NeuroPlex Supplement without Vitamin A, 10 ml
359.00 € 359.0 EUR
Gellan Gum 500g
79.99 € 79.99 EUR
Gellan Gum size: 100 g
36.99 € 36.99 EUR
Gellan Gum size: 1 kg
114.99 € 114.99 EUR
Gelatin from porcine skin, gel strength 300, Type A size: 100 g
120.00 € 120.0 EUR
GelRed® Prestain Plus 6X DNA Loading Dye size: 1 mL
146.28 € 146.28 EUR
GelRed® Nucleic Acid Gel Stain trail size size: 0.1 ml
164.00 € 164.0 EUR
GelRed® Nucleic Acid Gel Stain 10.000X in DMSO size: 0.5 mL
278.00 € 278.0 EUR
GelRED TM for Agarose or Page Gels 10000X in water size: 0.5 mL
229.00 € 229.0 EUR
GelNest Matrix, low growth factor, without Phenol Red
1.00 € 1.0 EUR
GelGreen® Nucleic Acid Stain, 10,000X in water size: 0.1 ML
222.40 € 222.4 EUR
GelGreen® Nucleic Acid Gel Stain, 10000X in water, 0.5 ml
277.00 € 277.0 EUR
GelGreen® Nucleic Acid Gel Stain size: 10 mL, 10,000X in water
2,400.00 € 2400.0 EUR
GelGreen® Nucleic Acid Gel Stain size: 10 mL, 10,000X in water
2,640.00 € 2640.0 EUR
GelGreen Nucleic Acid Gel Stain, 10,000X in DMSO size: 0.5ML
275.00 € 275.0 EUR
Gelsize:Bright Laser Diode Gel Illuminator
2,480.00 € 2480.0 EUR
Gel Drying Film
222.50 € 222.5 EUR
Gammasize:ECS | Gamma glutamylcysteine synthase
710.00 € 710.0 EUR
Gammasize:Aminobutyric Acid gABA ELISA Kit size: 96 tests
1,050.00 € 1050.0 EUR
GZMK recombinant protein :: Granzyme K Recombinant Protein, 0.1 mg
655.00 € 655.0 EUR
GW2580, Free Base, >99% size: 10g
2,703.37 € 2703.37 EUR
GVB++ with Ca and Mg size: 1L
636.00 € 636.0 EUR
GV3101 AGROBACTERIUM STRAIN
530.00 € 530.0 EUR
GV3101 pSoupsize:p19 ElectroCompetent Agrobacterium size: 6x50µl
779.00 € 779.0 EUR
GV3101 pSoupsize:p19 ElectroCompetent Agrobacterium
694.00 € 694.0 EUR
GV3101 pSoup ElectroCompetent Agrobacterium size: 6x50ul
779.00 € 779.0 EUR
GUINEA PIG, WHOLE BLOOD, ALSEVERS, DONOR, GENDER UNSPECIFIED, 100 ML
1,276.00 € 1276.0 EUR
GTP Tris Solution GMPsize:grade 100 mM size: 1ml
213.00 € 213.0 EUR
GT elisa kit :: Rat Glutathione ELISA Kitsize:96size:Stripsize:Wells
1,035.00 € 1035.0 EUR
GSTp active protein :: Glutathione S Transferase Pi GSTp Active Protein size: 0.1 mg
890.00 € 890.0 EUR
GSTm1 recombinant protein :: Glutathione S Transferase Mu 1 GSTm1 Recombinant Protein size: 0.1 mg
737.00 € 737.0 EUR
GSTA1 active protein size: 0.1 mg
627.00 € 627.0 EUR
GST assay kit :: Glutathione Ssize:Transferase GST Assay Kit size: 96 tests
386.00 € 386.0 EUR
GSSG elisa kit :: Rat Oxidized Glutathione ELISA Kitsize:96size:Stripsize:Wells
1,035.00 € 1035.0 EUR
GSKsize:3β Rabbit mAb,100 µg
320.00 € 320.0 EUR
GSH elisa kit :: Rat Reduced glutathione ELISA Kitsize:96size:Stripsize:Wells
1,035.00 € 1035.0 EUR
GSDME elisa kit :: Human Gasdermin E, GSDME ELISA Kit size: 96size:Stripsize:Wells
591.60 € 591.6 EUR
GSDMC elisa kit :: Human Gasderminsize:C ELISA Kit size: 96size:Stripsize:Wells
727.60 € 727.6 EUR
GSD Absorbance 96
5,441.00 € 5441.0 EUR
GRM7003size:25G Fast Blue B Salt
113.00 € 113.0 EUR
GPX4 elisa kit :: Human Glutathione Peroxidase 4 GPX4 ELISA Kit size: 96size:Stripsize:Wells
1,180.00 € 1180.0 EUR
GPX4 elisa kit :: Human Glutathione Peroxidase 4 GPX4 ELISA Kit size: 48size:Stripsize:Wells
950.00 € 950.0 EUR
GPR173 elisa kit :: Bovine G proteinsize:coupled receptor 173 ELISA Kit size: 96size:Stripsize:Wells
1,140.00 € 1140.0 EUR
GPCL99 size: Guinea Pig Complement Lyophilized size: 5ml
470.00 € 470.0 EUR
Antibody
520.00 € 520.0 EUR
GOT1 active protein :: Aspartate Aminotransferase Active Protein size: 25K Units
516.50 € 516.5 EUR
GOLGA6A Antibody 100µL
490.00 € 490.0 EUR
GNMT recombinant protein size: 0.1mg
360.00 € 360.0 EUR
GN Broth, Hajna size: 100 Gms
412.00 € 412.0 EUR
GMP Human ILsize:4 Protein size: 50 µg
952.00 € 952.0 EUR
GMOScreen RT IPC CsVMV / CV127 / DP305423size:1 Soy LR for ABI 7500 Fast size: 96 rxn
1,359.00 € 1359.0 EUR
GMOScreen RT 35S/NOS/ABII IPC LR size: 96 rxn
1,466.00 € 1466.0 EUR
GMOQuant IPC LR 35S Screen Corn size: 2 x 48 rxns
1,201.00 € 1201.0 EUR
GMOQuant Duplex IPC LR GTS 40size:3size:2 modification/Event MON89788 Soy
1,587.00 € 1587.0 EUR
GMOQuant LR 35S Screen Soy size: 2 x 48 rxns
1,257.00 € 1257.0 EUR
GLP1Rsize:22H Recombinant Human GLP1R Protein, Biotinylatedsize:50ugsize:100 µg
2,750.00 € 2750.0 EUR
GLP1Rsize:22H Recombinant Human GLP1R Protein, Biotinylatedsize:50ug
1,620.00 € 1620.0 EUR
GLP1R recombinant antibody 0.1 mg
564.40 € 564.4 EUR
GLP1R Antibody size: 100 µg
575.00 € 575.0 EUR
GLI2 elisa kit :: Human GLI family zinc finger 2 ELISA Kit size: 96size:Stripsize:Wells
1,248.19 € 1248.19 EUR
GLI1 elisa kit :: Human Gli ELISA Kit size: 96size:Stripsize:Wells
1,250.00 € 1250.0 EUR
GLI1 elisa kit :: Human Gli ELISA Kit size: 96size:Stripsize:Wells
1,250.00 € 1250.0 EUR
GLFRDA 102 GAA Genemer Control DNA Friedreich's At axia FRDA ; 500 ng
438.00 € 438.0 EUR
GIB DNA Extraction Refill Consumables refill kit for use with Genes in a Bottle Kit 1662300EDU , contains lysis buffer and powdered protease + salt, for 36 students
161.20 € 161.2 EUR
GHRL elisa kit :: Horse Ghrelin GHRL ELISA Kit 96 Tests
840.00 € 840.0 EUR
GHRELIN, HUMAN/RAT TOTAL / DETECTION, 125 test
1,289.00 € 1289.0 EUR
GGT1 active protein :: gammasize:Glutamyl Transferase Active Protein, 25K Units
1,575.00 € 1575.0 EUR
GFP+size:LUC+size:Stable Cell Linesize:SKOVsize:3 SCsize:LX013 size: 2 million cells/vial*1
5,773.00 € 5773.0 EUR
GFP Stable Cell Linesize:B16size:F10 Mouse size: One frozen vial
8,210.00 € 8210.0 EUR
GFP Rabbit Polyclonal Antibody size: 200 µg
620.00 € 620.0 EUR
GFP Expressing Human brain astrocytes size: 1mL frozen vial 500,000 cells
1,775.00 € 1775.0 EUR
GFP Expressing Human Umbilical Vein Endothelial Cells,500,000+ Cells frozen
1,630.00 € 1630.0 EUR
GFP Expressing Human Umbilical Vein Endothelial Cells GFPsize:HUVECs
2,300.00 € 2300.0 EUR
GFP Expressing Human Brain Astrocytes size: 500,000 Cells size: Frozen
1,919.00 € 1919.0 EUR
GFP Adenovirus, in vivo ready, 1 x 1011 IFU/ml x 50ul in PBS containing 5% sucrose, for in vivo applications.
1,275.00 € 1275.0 EUR